Ancient DNA: Methods and Protocols (17 page)

References

1. Brutlag D, Schlehuber C, Bonner J (1969) 7. Møller K, Rinke J, Alexander R et al (1977) Properties of formaldehyde-treated nucleohis—

The use of formaldehyde in RNA-protein

tone. Biochemistry 8:3214–3218

crosslinking studies with ribosomal subunits

2. Varshavsky A, Sundin O, Bohn M (1979) A

from

Escherichia coli
. Eur J Biochem

stretch of “late” SV40 viral DNA about 400 bp

76:175–187

long which includes the origin of replication is

8. Gilbert M, Haselkorn T, Bunce M et al (2007)

specifi

cally exposed in SV40 minichromo—

The isolation of nucleic acids from fi xed, paraf—

somes. Cell 16:453

fi n-embedded tissues-which methods are use—

3. Ilyin Y, Georgiev G (1969) Heterogeneity of

ful when? PLoS One 2:537

deoxynucleoprotein particles as evidencec by 9. Shi SR, Cote RJ, Wu L et al (2002) DNA ultracentrifugation of cesium chloride density

extraction from archival formalin-fi xed, paraf—

gradient. J Mol Biol 41:299

fi n-embedded tissue sections based on the anti—

4. Feldman M (1973) Reactions of nucleic acids

gen retrieval principle: heating under the

and nucleoproteins with formaldehyde. Prog

infl

uence of pH. J Histochem Cytochem

Nucleic Acid Res Mol Biol 13:1–49

50:1005–1011

5. Varshavsky A, Ilyin Y (1974) Salt treatment of

10. Shi SR, Datar R, Liu C et al (2004) DNA

chromatin induces redistribution of histones.

extraction from archival formalin-fi xed, paraf—

Biochim Biophys Acta 340:207–217

fi n-embedded tissues: heat-induced retrieval in

6. Jackson V (1978) Studies on histone organiza—

alkaline solution. Histochem Cell Biol

tion in the nucleosome using formaldehyde as a

122:211–218

reversible crosslinking agent. Cell 15:945–954

sdfsdf

Case Study: Ancient DNA Recovered from

Pleistocene-Age Remains of a Florida Armadillo*

Brandon Letts and Beth Shapiro Abstract

Warm, humid regions are not ideal for long-term DNA preservation. Consequently, little ancient DNA research has been carried out involving taxa that lived in, for example, tropical and subtropical regions.

Those studies that have isolated ancient DNA from warm environments have mostly been limited to the most recent several thousand years. Here, we discuss an ancient DNA experiment in which we attempt to amplify mitochondrial DNA from remains of armadillo, glyptodont, and pampathere from sites in Florida, USA, all believed to be around 10,000–12,000 years old. We were successful in recovering DNA from only one of these samples. However, based on the amount and distribution of DNA damage, the ancient DNA recovered was well-preserved despite the age and preservation environment. In this case study chapter, we discuss the experimental procedure we used to characterize the DNA from the Floridian samples, focusing on challenges of working with ancient specimens from warm environments and steps taken to confi rm the authenticity of the recovered sequence.

Key words:
Ancient DNA Extraction , Armadillo , Dasypus bellus , Mitochondrial DNA , Degraded DNA , Mefford Cave , Florida , Pleistocene

1.

Few ancient DNA (aDNA) studies have focused on Pleistoceneage animals that inhabited warm regions
( 1 )
. This is due in part to the poor preservation of such samples compared to those preserved in colder, temperature-stable envir
onments ( 2, 3
) . Remains from *
Note
: In the case study presented in this chapter, we describe DNA extraction and amplifi cation from ancient armadillo samples from Florida using a method similar to that presented in Chaps. 3 and 14 . Other DNA extraction methods, such as the phenol:chloroform method described in Chap. 2 , would also be appropriate for this type of sample. We discuss specifi c challenges associated with the analysis of ancient bone samples from warm regions.

Beth Shapiro and Michael Hofreiter (eds.),
Ancient DNA: Methods and Protocols
, Methods in Molecular Biology, vol. 840, DOI 10.1007/978-1-61779-516-9_12, © Springer Science+Business Media, LLC 2012

87

88

B. Letts and B. Shapiro

areas such as Florida, where the climate is both warm and humid, are expected to decay quickly and present considerable challenges to the extraction and amplifi cation of aDNA.

Pleistocene cingulates (armadillos, glyptodonts, and pampatheres) inhabited temperate to warm climates
( 4, 5 )
. The remains of Pleistocene armadillos are dispersed mainly across the gulf coastal plain of North America, but have been found as far north as Missouri, Tennessee, and Nebraska
( 6
) . As they are common in these Pleistocene deposits, the cingulates are ideal to explore DNA survival in Pleistocene samples from warm, even subtropical areas.

One reason for this abundance is that, in addition to skeletal components, each individual has around 1,000 osteoderms, which are the small bones that make up the carapace or shell. This results in a much larger number of preserved remains per individual, and therefore, a greater probability that some remains will be preserved.

Additionally, the variety of deposition sites (open sites, river banks, submerged river bottoms, caves) where they are found makes it possible to compare DNA yield between preservation

microenvironments.

2. Materials

and Methods

We obtained 17 armadillo, glyptodont, and pampathere samples collected from various locations in Florida that are now part of the University of Florida Museum of Natural History collection.

Samples were identifi

ed as belonging to

Dasypus bellus
,

Glyptotherium fl oridanum
, or
Holmesina septentrionalis
. All samples were estimated to be Rancholabrean in age, or about 10,000–12,000 years old. We performed ancient DNA extraction and PCR

set-up at the Pennsylvania State University in a sterile, positive-pressure ancient DNA laboratory that is spatially isolated from modern molecular biology research. Workfl ow was always from the ancient DNA laboratory to the modern DNA laboratory, and full protective coverings were worn at all times. Negative controls were used at all steps, and PCR products were cloned to characterize DNA damage and identify environmental contaminants.

Before subsampling, we cleaned the outer surface of each bone around the subsampling site using a Dremel tool equipped with a cutting disk. This removes preservative coatings and limits potential contamination by exogenous sources such as human handling.

As much as possible, care was taken to avoid the destruction of morphologically informative parts of the bones.

We removed subsamples from each bone using a Dremel tool

equipped with either a drill tip or cutting disk. We collected powder 12 Case Study: Ancient DNA Recovered from Pleistocene-Age…

89

from less dense samples by drilling directly into the interior of the bone. Drilling was the preferred method of subsampling due to its lower destructiveness; this process resulted in only a 2-mm hole and no other visible damage. We powdered bone fragments using a mikrodismembrator (Braun) by shaking at 600 rpm for

30 s–5 min, depending on the sample. For each specimen, we processed a fi nal mass of 400–500 mg of bone powder.

We extracted DNA using the silica-based method described in Chap. 3 . Darkly stained samples from river sites required modifi cation of the protocol to repeat the wash step until the silica became free of discoloration (two or three repeated wash steps depending on the sample). We eluted the DNA in 50 m L of TE buffer.

We fi rst attempted PCR amplifi cation of the conserved mitochondrial 12S rDNA fragment from each extracted sample. We designed primers based on the sequence of the extant armadillo, Dasypus novemcinctus,
as obtained from Genbank. We amplifi ed a 97-base pair (bp) fragment of 12S using the primers Xen12S-56F, 5 ¢ -ATCAGCACACCAGTGAGAATG-3 ¢ ; Xen12S-153R, 5 ¢ -GAG

CAAAGCGTTGTGAGCTAC-3 ¢ .

In addition to amplifying 12S rDNA, we designed fi ve overlapping primer sets to span 581 bp of the mitochondrial hypervariable region sequence that had been sequenced previously for modern Dasypus
( 7
) . We tested the primers using a modern individual, but, due to the high variability within this genomic region, had only limited success: only the 3 ¢ -most primer set resulted in amplifi cation. We attempted to optimize the experiment by amplifying fragments of progressively increasing length, beginning with the 3 ¢ -most primer and pairing it with reverse primers from the other primer sets. This optimization (progressive amplifi cation of longer fragments) was only ever performed using the ancient sample, so that no long fragments of amplifi ed DNA were ever produced from the modern individuals and any resulting sequence is therefore unlikely to be that of a modern contaminant.

We performed PCR amplifi cations in 25 m L reactions consisting of 50 m g rabbit serum albumin, 0.25 mM dNTPs, 1×

High Fidelity buffer, 1.25 units Platinum

Taq
High Fidelity

(Invitrogen), 2 mM MgSO , 1 m M of each primer, and 1 m L

4

DNA extract. Cycling conditions were 94°C for 60 s, followed by 50 cycles of 94°C for 30 s, 57°C (12S primers) or 50°C (control region primers) for 45 s, and 68°C for 45 s. No fi nal extension was used. We cloned and sequenced four PCRs using the TOPO

TA cloning kit (Invitrogen) in 1/10 reactions and BigDye ter-minator sequencing kit (Applied Biosystems) in 1/32 reactions.

To create a consensus sequence, we aligned the resulting products using the Lasergene software suite (DNAstar, Inc.).

90

B. Letts and B. Shapiro

3. Results

and Discussion

3.1. Sample

Only one of the 17 samples from which extraction was attempted
Preservation

yielded DNA. The sample was a tibia fragment from a Beautiful Armadillo,
Dasypus bellus
(UF 2478), from Mefford Cave, a lime-stone cavern in central Florida. The associated skeleton is the most complete that has been found and included within the carapace the skeletons of unborn offspring. The sample was extremely dry and brittle, and when powdered, was comparable to talcum powder.

The exterior of the bone was brown and mottled in appearance, but the interior was a creamy off-white color.

We performed two extractions from this sample using powder taken from opposite ends of the bone. This made it possible to determine whether DNA was preserved throughout the sample, compare levels of damage across the specimen, and assess the authenticity of the sequence in an independent extraction. DNA extraction attempted from an associated osteoderm from the site yielded no amplifi able DNA. This could suggest that preservation varied between different parts of the skeleton. It is also possible that bone structure may affect the preservation of DNA: osteoderms, which function as armor, are small, dense, and easily fossilized
( 8 )
.

An osteoderm from a river site also failed to yield DNA; however, a test extraction of three 20-year-old nine-banded armadillo osteoderms revealed that DNA is present in modern osteoderms.

3.2. Troubleshooting

We cloned three control region PCR products from the two extrac-

the Experiment

tions of the tibia and sequenced 39 clones. We identifi ed 13 single-ton substitutions: three C→T/G→A changes resulting from cytosine deamination; a transversion (A→C/T→G), most likely due to a polymerase misincorporation at an apurinic/apyrimidinic
site

( 9 )
; and nine A→G/T→C changes, which have also been shown to result from polymerase misincorporation in some ancient DNA samples
( 10 )
. The two extractions yielded identical consensus sequences.

The 5 ¢ end of the mitochondrial control region in the armadillo is highly repetitive
( 7
) . We found that this repetitive structure extended throughout the control region, making it diffi cult to design primers that would not bind in multiple places. Consequently, the products of each PCR comprised multiple, overlapping frag-

ments that varied in length (Fig. 1 ). Because of the degraded natur
e of the specimens, it was not possible to circumvent this problem by designing longer fragments to span the repetitive sequence.

We therefore chose to determine the control region sequence by cloning the PCR amplifi cations. This allowed us to separate the overlapping fragments and align them for a consensus sequence.

12 Case Study: Ancient DNA Recovered from Pleistocene-Age…

91

?

ACATACACTTATCTACCCCATACATATCAT ACATACA
T
TTATCTACCCCAT
G
CATATCA
C
CTAACCCTACACTGATCATCTCC

F4

F4

F4

F5

R5

375 bp

F4/R5

265 bp

F4/R5

F4
ACATACACYTATCTACCCCATACATATCAT

185 bp

F4/R5

F5
CYAAYCCTACACTGATCAYCTCC

120 bp

R5
ATGACCCTGAAGAAASAACCA

F5/R5

Fig. 1. Diagram showing the amplifi cation products from the Mefford Cave armadillo specimen. A highly repetitive control region in
Dasypus
results in primers binding in multiple places. Primer F4 binds in at least three places, represented by white boxes . The correct binding site produces a 265-bp fragment and is highlighted with
bold text
. The unintended binding sites are indicated with
boxes
containing
italicized text
. The actual F4 binding site sequence for the 265-and 185-bp fragments is indicated above the corresponding box. Mismatches in the 185-bp fragment priming site are in
bold
. The binding site sequence for F5 is also provided. Primer sequences are provided below the diagram.