kiDNApped (A Tara Shores Thriller) (12 page)

“Yes, that’s right—well I’m not sure about the respected part,” she joked, looking up from the forms. “And who might you be?”

“Bruce Watanabe, Director of our humble Institute. I’m terribly sorry to learn about your father’s disappearance. Have you heard any news? Is that what brings you to Hawaii?”

“I came here with my brother to hopefully try and find out what we can about what happened to my father. So far we haven’t turned anything up, but while I’m waiting for the investigation, I thought I might get some work done, so I collected a water sample I’d like to sequence for bacterial DNA.” She had decided it would be best not to mention the DNA encryption key. Kristen frowned at the bulk of paperwork in her lap and smiled up at Dr. Watanabe.

“I wish you the best of luck in the search for your father. He is of course held in the highest esteem by our scientists here at the university. I’m most pleased you came to us for your sequencing needs. I’d be happy to personally handle your request.”

“Thank you. Doctor Watanabe, I’d like to have the bacterial strain with the highest cell counts in this seawater sample sequenced as soon as possible. I can pay extra for rapid processing. Charge it to my research account that I indicated on the form,” she said, tapping the paper in her lap with a pen.

“Certainly, Doctor Archer. I’ll get it to the lab right away. How would you prefer the results be delivered to you? We can express mail a CD-ROM or flash-drive, or e-mail a file...”

“E-mailed file would be the best,” Kristen said. She’d want to be able to get the results from wherever she was when they came back. “How long do you think it will take?”

“As I said, for you, I’ll have them put a rush on it. Say four to eight hours, depending, of course, on the nature of your sample. If you leave me a contact number I’ll call to notify you when the sequencing is complete, or if any problems arise.”

With a last look at her sampling bottle, Kristen handed the vessel over to Dr. Watanabe.

…TTGG
22
GAAA...

1:25 P.M.

“How’d it go?” Dave asked, welcoming Kristen back into his shared rental house.

“Good,” she said, stepping inside. She told him about the four-to-eight hour wait for the results of the DNA sequencing. Then she saw Lance crashed on the couch.

“Is he okay? How long has he been out?” she asked, approaching her brother.

“He’s okay,” Dave said. “We had a few beers and then he just passed out. Rough night last night.”

Kristen watched the rise and fall of her brother’s chest to make sure he was breathing normally, then turned back to Dave.

“Listen, Dave, I hope we’re not inconveniencing you too much. We can go back to our hotel—”

“No worries. It’s fine, really. Feel free to make yourselves comfortable. My roommates will start coming in around five-thirty, six, and Agent Shores said she'd be stopping by. But listen: watching him sleep made me realize I’m pretty tired, too. I’ve seen a lot of action the last couple days myself. So if you don’t mind, I’m going into my room to take a nap.”

He waved an arm at her laptop, still open on the table. “Feel free to do some work if you want—there’s an internet cable over there somewhere—or if you want I can set up a spare bed for you...”

Kristen eyed her laptop. “Thanks, Dave. I think I’ll have another look at the file while I wait for the sequencing lab to call.”

Dave padded off to his room and shut the door. Kristen pulled a chair up to the laptop table. She woke up her machine. The parade of A’s, C’s, T’s, G’s and one’s and zero’s was there to greet her.

She considered the information on the document’s first and only page. On the boat, she’d had a look at the top group of characters, which seemed to relate four-digit binary strings to two-digit nucleic acid strings. Some kind of binary-genetic conversion, Kristen thought as she looked at it again now. Then she concentrated on the second grouping.

It was different than the first, and much simpler, consisting of only two lines:

GGGGGGGGGGGGGGGGGGGGGGGG

TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT

Kristen contemplated the simple character strings. G: Guanine. T: Thymine. Both essential building blocks of DNA. But she knew that it would be statistically improbable—no, pretty much
impossible
, she corrected herself—for so many of the same molecules to occur in a row naturally.

They represented artificially constructed strings—synthetic chains that would have to be engineered in a lab.

She doubted the choice of molecules was an accident, either. The letters themselves were significant. She knew her father would control every nuance of anything he was the architect of—nothing would be left to chance.

Kristen lay her head on the crook of her elbow, resting it on the table.
There would have to be a way to
know where it was in the DNA string that the coded message began and ended. Otherwise you would have to scan the entire length of DNA for the message, and even for the simplest of organisms, it would take way too long. These long mono-chains seem like logical indicators of where the message started and stopped.

But why G and T?

Then it hit her.
Stop thinking of the letters as chemical representations and start thinking of them as letters that make up words...

G:
Go
.

T:
Terminate
.

And then, at about the same time as the laptop’s screen went into hibernation mode, Kristen fell asleep.

5:16 P.M.

A cell-phone rang. Kristen’s. Jolted awake by its spastic chirping, the microbiologist glanced about the living room. Her brother still lay snoring on the couch. No one else was in the room. She picked up the phone and hit TALK.

“Good afternoon, Doctor Kristen Archer?”

“Speaking.”

“This is Tomoaki Matsura, from the UH sequencing lab. I’m calling to let you know that we completed the sequencing for your sample, and have e-mailed the results to the address you requested.”

Kristen rubbed her eyes and noted the time on her dive watch. Looking at it now reminded her that the man who had given her this gift was about to be declared dead. It also told her that the sequencing had been completed in just over four hours. Speedy work. Her reputation —and of course her father’s—must carry some weight.

“About how many bacterial strains were present in the sample, and which species is the most prevalent?”

“There are dozens of bacterial species in your sample, Dr. Archer, but by far the most prevalent is
Pelagibacter ubique
, so that’s the one we sequenced.”

Pelagibacter ubique
. Kristen knew that this microbe, as its species name suggested, was quite common in many marine environments. “Okay, thank you very much. If I have any questions about the results, is it alright if I contact you?”

Tomoaki assured her that it was, and she ended the call.

Kristen hunted down the internet connection wire Dave had mentioned and plugged it into her laptop. Online, she went to her web mail account. She downloaded the file from the lab and opened it.

Kristen saw immediately that the results were in what was known in bioinformatics circles as “plain format,” meaning only the nucleic acid characters were represented, with no spaces or other characters. The sequence ran for five pages of single-spaced, densely packed characters. Kristen considered a random selection from the first page:

ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGACCTGAAACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACCAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGCCTGGAGGGTATGCAGGAAGCGGCAGGAATAAGGCCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG

AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG…

This was the DNA sequence of the most common bacteria within the sample she’d collected on the dive. By itself, it meant nothing to her. But in combination with the DNA encryption code?

Kristen stared at the sequence. Was there information coded into it worth killing over? She knew that the first step to answering this question would be to search for the START-STOP sequences present in the second half of the key file. If those were in the bacterial DNA sequenced by the lab, then it could only mean that everything in between them had been deliberately inserted as coded information.

It also had to mean, the microbiologist in Kristen mused, that if some string of artificially constructed DNA
had
been inserted into the natural DNA of a living bacterial cell—and that cell remained viable—that it would have to be put into the so-called “junk DNA” sequences, which were not known to code for any essential life functions.

She copied the START sequence from the key file. “GGGGGGGGGGGGGGGGGGGGGG”. Then she pasted that string of characters into a “Find” window in the sequence file from the lab. Taking a deep breath, she clicked a button that would search the DNA sequence for the START, or “Go” sequence.

Three pages into the five-page sequence, the program highlighted a match.

Kristen slowly exhaled.
What if it’s only a coincidence?
She went back to the encryption key file, this time copying the STOP, or “Terminate” sequence.

“TTTTTTTTTTTTTTTTTTTTTTTTTTTT.”

She searched for it in the same way against the sequencing results.

Match!

Halfway down page five.
That’s too much to be coincidental. So the string of A’s, C’s, T’s and G’s in between the START and STOP sequences must contain some kind of coded message!

Excited, she went back to the flash-drive file.

How to decode the message?

She looked at the coded file again.
This key must make the binary code compatible with the genetic code—some kind of conversion factor.
Her eyes bored into the screen, focusing on the binary digits:

0000-AA-0001-CA-0010-GA-1000-AG
1111-AT 0011-CC 0110-TT 0100-AC

0111-CG 1010-CT 0101-GC 1001-TG

1110-GT 1011-TC 0010-GA 1100-GG
 

The dashes seemed to be relating the four-digit binary strings with the two-digit nucleic acid strings. Kristen knew that binary code could somehow represent the entire alphanumeric system, but she couldn’t remember exactly how. She considered waking her snoring brother, but decided instead to look it up on her own.

She went to Internet search engine Google and typed in “binary code alphabet.” Clicking on the first result she saw yielded:

A 01000001

B 01000010

C 01000011

D 01000100

E 01000101

F 01000110

G 01000111

H 01001000

I 01001001

J 01001010

K 01001011

...

The code continued through the letter Z, and also included numbers. She straightened up in her chair, awakened by a realization:

Eight digits! It takes eight binary digits to equal one alphabet letter. But the key code only uses four binary digits at a time.

She looked once again at the first line of the encryption key:

0000-AA 0100-AC 0010-GA 1101-TA 1000-AG

Then she took a notebook and pencil from her backpack. On the laptop she positioned the windows so that she could see the bacteria’s sequenced DNA and the flash-drive’s encryption key at the same time. She scribbled the first two letters (nucleic acids) of the sequenced DNA found within the START and STOP strings in her pad:

AC

Then she found that two-letter pair, AC, in the key file. She wrote down the binary digits it was paired with:

0100

She repeated the process for the next two letters in the sequenced DNA: AG. In the encryption code, AG was paired with... she squinted as she searched for the digits on the screen...1000. Kristen wrote this binary string down next to the previous one, to get an eight digit string:

01001000

Then she went back to the binary code from the Internet. The eight digit binary string
“01001000” corresponds to the letter...

H

Encouraged, Kristen repeated the process for the next several characters. She worked rapidly, scanning the codes and quickly writing down the corresponding letter before moving on to the next two base pairs. After over an hour of decoding, Kristen realized that she was starting to repeat the same sequences over and over again.

She wrote the deciphered characters, including the binary code for the space character, together on one line. She wrote very quickly, jotting the characters down without considering their meaning until she had finished. When at last she actually read the results of her laborious translation, she screamed out loud.

“Oh God, no!”

…CGGA
23
TTTG...

6:57 P.M.

“Everything okay?”

The unexpected voice at the door made Kristen jump. She looked up from the laptop to see Tara Shores standing in the doorway, eyes scanning the inside of the house.

“I—I don't know,” Kristen stammered, turning back to the laptop. Tara walked over to the table, noticing Lance passed out on the couch on her way across the room.

“Where's Dave?” she asked. She was dealing with three people, so she would keep track of all three of their whereabouts. This kind of situational awareness was second nature to Tara.