Loop (12 page)

Still holding her to him, he shifted positions and tried to lay her down on the bed. But she resisted slightly, so that she ended up sitting on the floor with her back pushed up against the edge of the bed.

Pinned against a sickbed missing its owner, hunched over with death a burden on her shoulders, Reiko tried to confront the sexual impulses pressing in on her. The spectre of death was assaulting her from everywhere, except the direction from which lust came, boiling up as if to prove that she was still alive. Then she thought of how her son at this very moment was undergoing cruel tests, and the knowledge enervated her desire. Her maternal instincts began to crowd out her sexual needs.

But not Kaoru. He was beyond reining in now, as his mind and body came together in pursuit of a single goal.

He didn't care that Reiko was infected with MHC. He was aware of the data showing that the virus spread even more easily through genital contact than oral, but for the moment that knowledge was clean gone from him.

He sat down next to her, intertwined with her, on the floor of the sickroom. He placed his mouth over hers, nimbly undid the buttons of her blouse. These bold, play boyish actions surprised even him: he was relatively inexperienced at romance.

While Kaoru basked in his memories of the previous afternoon, Hideyuki obstinately hammered away on the dangers of exposing oneself to the virus.

…
Your blood test came back negative?
…
I
was your age once
-
you 've got to be careful with women… You can't let yourself get careless… Don't give in to momentary temptation…

The words went right over Kaoru's head. He couldn't look his father in the eye. The pure, simple act of loving a woman had become a betrayal of his father's expectations.

"Hey, kiddo! Are you listening to me?"

Hideyuki threw a monkey wrench into the workings of Kaoru's reverie. It had been ages since he'd called Kaoru "kiddo". Kaoru gradually let himself be pulled back to the present moment.

"Don't worry, I said."

Hideyuki still showed no signs of softening his suspicious gaze.

They stared at each other in silence for a while.

They exchanged more information that way than they'd been able to communicate in words. Then Hideyuki reached out and touched Kaoru's knee once more.

"Don't you get it? You're my greatest treasure."

Kaoru placed his hand over his father's.

"I know, Dad."

"I don't want you giving in to this. You've got to fight it. You've got to concentrate all your intelligence on confronting this enemy that wants to destroy your body, your youth."

Reiko was imploring him to
help;
his father was ordering him to
fight.
He felt pressure from both sides. But if he had been infected with MHC, if he was at risk of developing metastatic cancer, then those imperatives would cease to be things external to him. He'd have to rouse himself to action in order to protect his own body.

Hideyuki returned to his previous topic. "When Saiki was here he was telling me how all my old colleagues were succumbing to this disease, one after the other, and it struck me. I know a lot of cancer victims."

"I guess so," Kaoru grunted. He, too, knew a lot of carriers of the MHC virus.

"Maybe there's a reason."

"Like, maybe researchers are particularly susceptible?"

"This should be right up your alley. You're the one who ferreted out those longevity zones from the gravitational anomaly map. Listen to me. I want you to make a distribution map of people with MHC in Japan and America. Or a breakdown of infected people by occupation. Anyway, just gather all the data you can and come up with some statistics."

"Okay. I'll give it a try."

"I've got a feeling about this. I don't think it's a coincidence that we have so much sickness around us."

Still looking up at the ceiling, Hideyuki stretched his hand out to the sideboard and groped around as if searching for something. Kaoru noticed a stack of printed matter there, dozens of pages. He picked them up first and showed them to his father. "Is this what you're looking for?"

The first page contained the following sequence of letters:

10  20

AATGCTACTACTATTAGTAGAATTGATGC

30 40 50

CACCTTTTCAGCTCGCGCCCCA…

Kaoru recognized it at a glance: it was a chromosomal base sequence. "Saiki left those."

"What chromosomes was he analyzing?" "This, of course," Hideyuki said, tapping his own chest. Now that the daily wash of tests was suggesting that the cancer had spread to his lungs, all he had to do to indicate the cancer virus was to point, with contempt, at his chest.

This is the complete base sequence of the Metastatic Human Cancer Virus.

Moved, Kaoru looked at the sequence of letters again. The dozens of pages he held in his hands contained the base sequences for nine genes; they held thousands, even tens of millions of letters; they held the blueprint for the virus that bedeviled them.

First off, Kaoru decided to visit the lab that maintained the massive memory banks of the Loop. The history of the imaginary universe known as the Loop was stored in 620 terabytes of holographic memory; even now, twenty years later, it was safe and sound.

To get to the lab, it was faster to take the New Line than the old subway system. Kaoru left the university hospital and headed for the station.

He only walked for a few minutes, but by the time he boarded, his T-shirt was wet with perspiration. It being early afternoon, there were few passengers. As a result, the air conditioning cooled the air a little too efficiently for Kaoru. In no time, his T-shirt felt clammy and cold against his skin.

He had a seat and took from his briefcase the stack of printouts he'd just gotten from his father, containing the entire base sequence of the MHC virus. The sequence consisted of the letters A, T, G, and C, representing the different varieties of nucleotides. He could, he knew, stare at it forever and it still wouldn't get him anywhere in particular. But he had nothing to do. If he'd had a paperback he'd be idly flipping through it right about now, but as it happened his briefcase contained nothing else to pass the time with.

A gene is essentially a unit of information, and the MHC virus had a mere nine of them. By way of comparison, a human being has something like 300,000 genes-so the virus's total was fairly small.

Each gene can be represented by a sequence of a few thousand to a few hundred thousand bases; three bases form one amino acid. So, for example, a string of three thousand letters (ATGC… and so on) means that a thousand amino acids have all joined hands to create a protein.

Kaoru scrutinized page after page, and when his eyes got tired he lifted his head and gazed out the window at the scenery. The print was so small that trying to focus on it through the jostling of the train was making him queasy. Above each row of letters was a series of numbers in multiples of ten, allowing the viewer to tell at a glance what number in the sequence each letter was.

By scanning these numbers it was an easy matter to figure out how many bases constituted each of the nine genes. They ranged from a few thousand to hundreds of thousands. In order, they were:

Gene #1: 3072 bases

Gene #2: 393,216 bases

Gene #3: 12,288 bases

Gene #4: 786,432 bases

Gene #5: 24,576 bases

Gene #6: 49,152 bases

Gene #7: 196,608 bases

Gene #8: 6144 bases

Gene #9: 98,304 bases

Kaoru stood up and moved over to the door. The breeze from the air conditioner had been hitting him on the left side of his body. He especially disliked this kind of unnatural chill; if the cost of sitting was freezing, he'd just as soon stand.

As he leaned against the door he idly pictured Reiko's face. But visions of his father's attenuated features kept coming to mind.

The research centre where he was headed was a partial leftover of the place where his father had once worked. Kaoru knew that twenty-five years ago, upon finishing his doctorate, his father had been invited to join the Loop project, and that his father had devoted the next five years to researching artificial life. He didn't, however, know the specifics of what his father had been researching. It had all been before Kaoru was born.

Every time he tried to ask, his father became close-mouthed. But the project hadn't ended well: that much Kaoru had been able to guess. Hideyuki was the type to jump up and down and celebrate when his work was successful, but he'd clamp his mouth shut tight in the wake of failure. Once Kaoru recognized the signs, he realized it wouldn't do to keep rooting around.

But this time-maybe it was his age, or maybe his illness had softened him-when Kaoru had made to leave his father's sickroom with the sheaf of papers in his hand, Hideyuki had stopped him with a word.

"Kiddo."

Then his father, on his own initiative, had brought up the topic of his research some two decades before.

"My area was to come up with a computer simulation of the emergence of life."

His explanation was simple: for years it had been his dream to elucidate how life had first appeared on earth. But, as Kaoru had guessed, the experiment had come to an unforeseen conclusion, and it had been put on ice. His father didn't use the word "failed". As far as he was concerned, the experiment as an experiment could be considered a resounding success. But he still couldn't figure out why it had come out the way it had.

"The Loop… well, you might say it turned cancerous."

By which he meant that all the patterns in the program had been assimilated into one set pattern: all diversity vanished, and the program ground to a halt.

To Kaoru it sounded like his father was rambling. He didn't know what to make of all this. And it was no wonder: he knew nothing about the project's methodology, and he couldn't see it as a whole.

But he did have a desire, first of all, to understand what it was his dad had been working on. And, second, he wanted to find out whether or not it was a coincidence that most of his father's colleagues from the lab had died from the MHC virus.

So it had been Kaoru's idea to visit the research centre. His father had given him the name of a surviving colleague and done what he could to ensure that the visit went smoothly.

Word from his father would doubtless have reached somebody at the research centre by now. Kaoru had every expectation that he'd be received courteously.

He glanced down at the paper again.

There was something about the total number of bases in each gene that was tugging at him.

The top page held nine numbers, ranging from four to six digits, each number representing the bases in one gene.

3072

393,216

12,288

786,432

24,576

49,152

196,608

6144

98,304

Kaoru had a special ability when it came to numbers; it was this ability that was sending up a red flag now. But he couldn't put his finger on exactly why. He felt like there was something these numbers had in common. Yes, he was sure of it. His intuition on that point was strong.

To clear his mind he gazed at the scenery outside the window. On both sides of the tracks tall buildings clustered; the streamlined train threaded its way between them silently.

The train slowed down as it approached a platform. He saw a building under construction, and beyond it another painted in bright primary colours.

The station was in a cluster of four skyscrapers, each a thousand feet tall, organically connected into a single city-within-a-city. It had an English name; everybody knew it.

The Square Building.

"Square." He knew what it meant: a quadrilateral with each side the same length. But it had another meaning, as well.

Kaoru looked down again at the printout, concentrating on the nine numbers.

"It couldn't be," he murmured. He recalled that the English word "square" also referred to the process of multiplying a number by itself. And with that, it came to him.

3072 = 2(10) X 3

393,216 = 2(17) X 3

12,288 = 2(12) X 3

786,432 = 2(18) X 3

24,576 = 2(13) X 3

49,152 = 2(14) X 3

196,608 = 2(16) X 3

6144 = 2(11) X 3

98,304 = 2(15) X 3

It was astonishing: each number equalled two to the power of
n
times three.

Kaoru made some quick mental calculations as to the probability of nine random four to six digit numbers all turning out to equal
2n
x 3. There were only eighteen such numbers in all the possible figures up to six digits.

Kaoru didn't need to come up with the exact probability, though: it was breathtakingly close to zero.

Why do this virus's gene sequences come out to 2n x 3?

The chances of it happening were basically zero, and yet it had happened. These nine numbers had surmounted that wall of improbability. It couldn't be a coincidence. He had to proceed under the assumption that it meant something.

He could remember coming to the same conclusion during that debate with his father ten years ago. That time the topic had been the emergence of life. Oh, and superstitions, jinxes… It was best to think that behind every amazing coincidence was some entity pulling strings.

An announcement came on to say that the train had reached Kaoru's station. The voice sounded to Kaoru like it was coming from far, far away.

Kaoru was expelled from the train doors onto the platform. If his father was to be believed, it was only a ten minutes' walk from the station to the research centre.

Kaoru wandered the hot platform, looking like an apparition. The sudden transition from the chilled train interior to the oppressive heat outside had left him tired.

He placed the stack of papers back into his briefcase and followed his father's directions to the research centre.