Read Ancient DNA: Methods and Protocols Online
Authors: Beth Shapiro
As most ancient DNA NGS studies to date have used either the Roche 454 or the Illumina Solexa sequencing platform, we will focus on barcoding strategies for these instruments. Prior to introducing these protocols, we fi rst present some brief recommenda-tions about designing the adapters that will be used to barcode the sequences.
1.2. Adapter Design
As more than 99% of template molecules can be lost in the adapter ligation process
( 6 )
barcoded sequencing libraries of ancient DNA extracts should be obtained after no more than one adapter ligation. Thus protocols such as Parallel Tagged Sequencing (PTS)
( 3
) that ligate the barcodes and sequencing adapters independently are not ideal for barcoding of low copy number templates. Consequently, barcodes must be designed to contain the complete sequencing adapter or a portion of the sequencing adapter for the sequencing platforms that is to be used. Protocol 1 requires the adapters to be biotinylated for a post-ligation purifi cation step (steps 7–10).
However, downstream applications such as Primer Extension
Capture (PEC)
( 7 )
require nonbiotinylated libraries. We therefore recommend ligating truncated, biotinylated, and barcoded adapters to the target initially, and subsequently bring them to full length by amplifi cation with tailed primers containing the remaining
adapter sequence (Fig. 1 ). This has the additional benefi
t of reducing the length of the adapters and thereby the cost of the oligonucleotides. In general, one barcode per molecule is suffi cient. Using barcodes on both sides of the target molecule (double barcoding) 19 Generating Barcoded Libraries for Multiplex High-Throughput Sequencing 157
Roche 454 barcoding
454_emPCR_A
454_emPCR_A
barcode
454_prim_A_ext
454_prim_B_ext
454_adap_A1
454_adap_B1
target
454_quant_A
454_quant_B
Illumina Solexa barcoding
barcode
Sol_amp_P5
Sol_amp_P7
Sol_prim_P5_ext
Sol_prim_P7_ext
Sol_adap_P5
Sol_adapt_P7
target
Sol_quant_P5
Sol_quant_P7
Fig. 1. Scheme of relative location of adapters, primers, and barcodes for Roche’s 454 Titanium and Illumina’s Solexa platform, respectively. Note that the barcodes on the A adapter (454) and P5 adapter (Illumina) are optional.
in most cases reduces the target read length, but provides valuable additional information to assess the quality of the data. For example, double barcoding makes it possible to identify cross-contamination between barcodes and potential jumping PCR artifacts
( 8
) .
T
able 1 pr
ovides example adapter sequences for the Roche 454
sequencing platform and T
able 2
shows example adapter sequences for the Illumina Solexa sequencing platform. For both sequencing platforms, each adapter consists of two single-stranded oligos that need to be hybridized to form the double-stranded adapter. To achieve directional blunt-end ligation, the plus strand oligo should be longer than its complement with the overhang on the 5 ¢ side of the plus strand (i.e., the side that does not ligate to the target). To achieve better ligation effi ciency and adapter stability, we recommend using phosphorothioate (PTO) bonds for the four 5 ¢ most and the four 3 ¢ most nucleotides of each oligo
( 9
) .
Illumina’s indexing system differs in that the barcodes (indexes) are placed
within
one of the adapters (P7) rather than at the end of the adapter
( 3, 10 )
(Fig. 1 ). The bar
code sequence is identifi ed in a separate short sequencing read. This setup allows for a high degree of fl exibility in experimental design, because libraries are fi rst prepared with universal adapters, and different indexes can be added repeatedly by amplifi cation with tailed primers just prior to target capture or sequencing
( 4
) . However, if double barcoding is to be used without modifying the sequencing software, the second 158
M. Knapp
et al.
Table 1
Example for designing barcoded 454 titanium shotgun adapters Laboratory code
(Name in protocol)
Oligo sequence and description
454_adap_A1
T*G*C*G*TGTCTCCGACTCAGacac*a*c*a*c
(Adapter_1)
Truncated A-Adapter with barcode (small letters are barcode) 454_adap_A1_rev
g*t*g*t*gtgt*C*T*G*A
(Adapter_1_rev)
Complement of barcoded A-Adapter (small letters are barcode) 454_adap_B1
[Btn]T*G*C*C*TTGGCAGTCTCAGgtgt*g*t*g*t
(Adapter_2)
Truncated, biotinylated B-Adapter with barcode (small letters are barcode) Barcode optional
No biotin required for Protocol 2
454_adap_B1_rev
a*c*a*c*acac*C*T*G*A
(Adapter_2_rev)
Complement of biotinylated B-Adapter with barcode (small letters are barcode)
Barcode optional
454_prim_A_ext
CCATCTCATCCC
TGCGTGTCTCCGACTCAG
(ext_primer_F)
Tailed A primer to extend truncated A-Adapter to full length (Tail in italics) 454_prim_B_ext
CCTATCCCCTGTG
TGCCTTGGCAGTCTCAG
(ext_primer_R)
Tailed B primer to extend truncated B-Adapter to full length (Tail in italics) 454_quant_A
TGCGTGTCTCCGACTCAG
(quant_primer_F1)
Short primer to amplify and quantify library with truncated adapters in quantitative PCR
454_quant_B
TGCCTTGGCAGTCTCAG
(quant_primer_R1)
Short primer to amplify and quantify library with truncated adapters in quantitative PCR
454_emPCR_A
CCATCTCATCCCTGCGTGTC
(Amp_primer_F)
Short primer to amplify and quantify library with complete adapters (after extension with 454_prim_A_ext) in quantitative PCR
454_emPCR_B
CCTATCCCCTGTGTGCCTTG
(Amp_primer_R)
Short primer to amplify and quantify library with complete adapters (after extension with 454_prim_B_ext) in quantitative PCR
*Phosphorothioate (PTO) bond
[Btn]: Biotin; A list of suitable barcodes can for example be found in
( 3
) barcode still has to be attached to the truncated P5 adapter in the same way as for the 454 platform. The truncated P7 adapter does not have to be barcoded as the barcode is part of the tailed primer
(“Sol_prim_P7_ext” in Fig. 1 and T
able 2
) used to extend the truncated P7 adapter to full length.
19 Generating Barcoded Libraries for Multiplex High-Throughput Sequencing 159
Table 2
Example for designing barcoded Illumina Solexa adapters Laboratory code
(Name in protocol)
Oligo sequence and description
Sol_adap_P5_1
A*C*A*C*TCTTTCCCTACACGACGCTCTTCCGATCTac*a*g*t*g
(Adapter_1)
Truncated P5-Adapter with barcode (small letters are barcode) barcode optional
Sol_adap_P5_1_rev
c*a*c*t*gtAGATCGGA*A*G*A*G
(Adapter_1_rev)
Complement of barcoded P5-Adapter (small letters are barcode) barcode optional
Sol_adap_P7
[Btn] G*T*G*A*CTGGAGTTCAGACGTGTGCTCTTCCG*A*T*C*T
(Adapter_2)
Truncated, biotinylated P7-Adapter
No biotin required for Protocol 2
Sol_adap_P7_rev
A*G*A*T*CGGA*A*G*A*G
(Adapter_2_rev)
Complement of biotinylated P7-Adapter
Sol_prim_P5_ext
AATGATACGGCGACCACCGAGATCT
ACACTCTTTCCCTACACGA
CGCTCTT
(ext_primer_F)
Tailed P5 primer to extend truncated P5-Adapter to full length (tail in italics) Sol_prim_P7_ext_1
CAAGCAGAAGACGGCATACGAGAT
cactgtGTGACTGGAGTTC
AGACGTGT
(ext_primer_R)
Tailed P7 primer to extend and barcode truncated P7-Adapter (tail in italics, small letters are barcode)
*Sol_amp_P5
AATGATACGGCGACCACCGA
(Amp_primer_F)
Full-length-library amplifi cation primer P5 (for amplifi cation of barcoded, preamplifi ed)
*Sol_amp_P7
CAAGCAGAAGACGGCATACGA
(Amp_primer_R)
Full-length-library amplifi cation primer P7 (for amplifi cation of barcoded, preamplifi ed libraries)
Sol_quant_P5
ACACTCTTTCCCTACACGACGCTCTT
(quant_primer_F)
Short primer to amplify and quantify truncated library in quantitative PCR
Sol_quant_P7
GTGACTGGAGTTCAGACGTGT
(quant_primer_R)
Short primer to amplify and quantify truncated library in quantitative PCR
[Btn]: Biotin
PTO bond.
As the tailed P7 primer also includes a barcode, they cannot be used as universal primers to amplify differently barcoded libraries. It is therefore recommended to use these truncated primers to amplify barcoded libraries. A list of suitable barcodes can for example be found in
( 4 )
2. Materials
2.1. Materials Needed
1. T4 DNA Polymerase.
for Protocol 1
2. T4 Polynucleotide Kinase.
and Protocol 2
3. T4 Ligase, including 50% PEG-4000 solution.
160
M. Knapp
et al.
4. Bst DNA Polymerase, Large Fragment, including 10× ThermoPol buffer.
5. 10× Buffer Tango.
6. ATP, 100 mM stock solution.
7. dNTPs, 25 mM each.
8. Water, ultrapure.
9. 0.1× TE buffer (with and without 0.05% Tween 20): 10 mM
Tris–HCl, 0.1 mM EDTA, pH 8.0. To prepare 50 mL of
0.1× TE, add 10 m L 0.5 M EDTA, pH 8.0 and 500 m L 1 M
Tris, pH 8.0 to a 50-mL falcon tube and add ultrapure water to 50 mL. If desired, add 25 m L Tween 20 to obtain 0.1× TET
(0.05% Tween 20) (see Note 1).
10. Qiagen MinElute PCR Purifi cation Kit (for Protocol 2 this Purifi cation kit is only needed if amplifi cation products shorter than 100 bp are to be purifi ed).
11. 10× Oligo hybridization buffer: 500 mM NaCl, 10 mM
Tris–Cl, 1 mM EDTA, pH 8.0. Fill 5 mL of 5 M NaCl into a
falcon tube and add 45 mL of 1× TE.
12. Agencourt AMPure XP DNA purifi cation kit (Beckman
Coulter) (Solid Phase Reversible Immobilization, (SPRI)
Technology).
13. 70% Ethanol.
14. Amplitaq Gold DNA Polymerase with Buffer II and MgCl 2
solution (Applied Biosystems).
15. Barcoded adapters and amplifi cation primers (as above).
16. Agencourt SPRICourt 96R Magnet Plate (Beckman Coulter) or 96 well Magnetic-Ring Stand (Applied Biosystems).
17. Thermal cycler with heated lid.
18. Real-time PCR machine.
19. Quantitative PCR reagents suitable for the real-time PCR
machine use. For Protocol 1, it is essential that the polymerase used can read acr
oss uracil (see Subheading 3.2.7 for details).
20. Consumables including 0.2-mL PCR tubes (single, 8 strip, 12
strip, 48 well or 96 well plate depending on size of experiment), 1.5-mL microcentrifuge tubes, 50-mL Falcon tubes.
2.2. Materials Needed
1. 1× TE buffer: 10 mM Tris–HCl, 1 mM EDTA, pH 8.0. To
Only for Protocol 1
prepare 50 mL of 1× TE, add 100 m L 0.5 M EDTA, pH 8.0
and 500 m L 1 M Tris, pH 8.0 to a 50-mL falcon tube and add ultrapure water to 50 mL.
2. 2× BindWash buffer (2× BWT): 2 M NaCl, 10 mM Tris–Cl, 1 mM EDTA, 0.05 % Tween-20, pH 8.0. Fill 20 mL of 5 M
NaCl into a falcon tube and add 30 mL of 1× TE. Add 25 m L
Tween-20 (see Note 1).
19 Generating Barcoded Libraries for Multiplex High-Throughput Sequencing 161
3. 1× BindWash buffer (1× BWT): 1 M NaCl, 10 mM Tris–Cl, 1 mM EDTA, 0.05% Tween-20, pH 8.0. Fill 10 mL of 5 M
NaCl into a falcon tube and add 40 mL of 1× TE. Add 25 m L
Tween-20 (see Note 1).
4. Invitrogen M-270 Dynabeads or MyOne C1 beads (Streptavidin beads).
2.3. Materials Needed
1. (Optional) EB buffer (supplied with Qiagen MinElute PCR
Only for Protocol 2
Purifi cation kit): 10 mM Tris–HCl, pH 8.5.
3. Methods
3.1. Prepare Indexing
Set up the following hybridization reactions in 0.2-mL PCR
Adapters
tubes.
1. Prepare a master mix including 10 m L Adapter_1 (500 m M), 10 m L Adapter_1_rev (500 m M), 10 m L 10× Oligo hybridization buffer and 70 m L of ultrapure water.
2. Repeat step 1 with Adapter_2 and Adapter_2_rev in a separate 0.2-mL PCR tube.
3. Incubate the reactions in a thermal cycler using the following profi le: 95°C 10 s, ramp to 14°C (0.1°/s) (see Note 2). This will produce double-stranded adapters (dsAdapter_1 and
dsAdapter_2) at a concentration of 50 m M.
3.2. Protocol 1
Production of barcoded sequencing libraries from highly degraded, low copy number DNA extracts.
3.2.1. Blunt-End Repair
1. Prepare a master mix for the required number of reactions.
The specifi c details of the composition of the reaction are provided in T
able 3 . Mix car
efully by pipetting up and down or fl icking the tube with a fi nger. Do not vortex after adding enzymes. Keep the master mix on ice if not immediately used to maintain full enzyme activity.
2. Add 20 m L master mix to 20 m L sample dissolved in EB, TE, or water to obtain a total reaction volume of 40 m L and mix.
Incubate in a thermocycler for 15 min at 25°C followed by
5 min at 12°C (see Note 3).
3. Immediately purify the reaction over a Qiagen MinElute silica spin column according to the manufacturer’s instructions.
Elute in 20 m L 0.1× TE + 0.05 % Tween-20.
3.2.2. Adapter Ligation
1. Prepare a ligation master mix for the required number of reactions. Specifi c details of the composition of the reaction are provided in T
able 4 . Since PEG is highly viscous, vor
tex the 162