Regenesis (33 page)

Figure 8.2
Hello World

Undergrads were now doing things, largely in a spirit of fun, that professional molecular biologists would have been hard-pressed to achieve a mere ten years earlier.

The following year, iGEM attracted teams from Canada, England, and Switzerland, and participation has grown steadily since then. The 2006 iGEM finally took on the trappings of a formal competition, with judging panels, prizes, and categories such as best part, best device, best system, best presentation, and even “best conquest of adversity” The jamborees themselves, meanwhile, increasingly resembled Olympic-level sporting events, with competitors showing up in team costumes, carrying away trophies, and building human pyramids on the playing field to celebrate victory.

Some of the genetic systems they designed worked so well that they had commercial possibilities. Students from the University of Edinburgh won the 2006 iGEM prize for the best real-world application with a bacterial arsenic sensor for drinking water. Whereas existing assays had a sensitivity of 50 parts per billion (ppb), the team's
E. coli
sensor could detect
concentrations of arsenic as low as 5 ppb. In the 2007 competition, the team from UC Berkeley engineered
E. coli
to produce a blood substitute that could be freeze-dried and stored, and then could be reconstituted and grown up in large volumes when needed. In 2008 the grand prize winner and official recipient of the Biobrick Trophy, a large silver Lego block bearing the iGEM logo on one face, was the team from Slovenia (which had also been the winner in 2006), which this time created a synthetic vaccine for the pathogen
Helicobacter pylori
, the cause of stomach ulcers.

The 2010 iGEM Jamboree turned out to be the biggest and best of them all—the last one in which all the teams met and competed at a single location, which as it happened was iGEM's birthplace and continuing home base, MIT. As a venue for a synthetic biology intercollegiate competition, MIT was spiritually, emotionally, and symbolically correct: it was internationally renowned as one of the world's top educational and research institutions for techies, computer geeks, and all-around science, technology, and engineering fanatics. During World War II, MIT's Radiation Laboratory (“Rad Lab”) was home to pioneering work on inventions such as radar and LORAN (long-range navigation). More recently, it has been noted for work in robotics, machine learning, cybernetics, and the theory and practice of artificial intelligence.

The Rad Lab connection brings to mind the fourth industrial revolution—the electro-magnetic industrial revolution. This was precipitated in 1870, when James Clerk Maxwell built models that unified electricity, magnetism, and light. He is best known for stating Maxwell's equations—a set of four equations, each of which, somewhat comically, was stated by and named after others. Maxwell's equations are, in the usual sequence, Gauss's law for electricity, Gauss's law for magnetism, Faraday's law of induction, and Ampere's law with Maxwell's correction. These equations have a quirky visual appeal to them, and are popular on T-shirts, with a top caption reading “And God said,” followed by the equations and a subcaption: “and then there was light.” There's also a poster saying: “What part of” (the equations) “didn't you understand?”

Maxwell's equations model the relationships between electricity and magnetism as well as the wavelike behavior that constitutes electromagnetic radiation. “Then there was light” includes not only visible light but also radio waves, microwaves, infrared, ultraviolet, and cosmic rays. The huge success of this unification of two fields of physics set the stage for later successes in unifying the main forces in physics and aiming us toward grand unification theories. Oh, and a very prolific set of civilization-changing inventions, like television, satellites, and cell phones.

It's hard to overstate the significance of electromagnetic radiation in the ancient evolution of life, ranging from the development of photosynthesis to the genesis of vision, and in the future of nanobiotechnology, running the gamut from photolithography to the creation of optical sensor networks.

However ideologically suited MIT was to an iGEM jamboree, physically the place was a maze, a vast, sprawling assemblage of industrial and anonymous-looking buildings that run for about a mile along the Cambridge side of the Charles River. It takes a while to get spatially oriented to the layout, because at MIT one building looks pretty much like the next, and indeed in many cases several of the buildings physically merge with one another to form a seamless megastructure. As a further aid to confusion, MIT's buildings tend to be known by number rather than by name (though each does have a name). The total effect on a newcomer is akin to being dropped into a secret government intelligence-gathering complex located in a hitherto undiscovered foreign country. In his book about MIT,
Up the Infinite Corridor: MIT and the Technical Imagination
, Fred Hap-good observes that the practice of referring to buildings by number fosters the impression that “they were just larger rooms in a single enormous building. . . . Building 7 feeds into 3 and 3 sits next to 10 and 10 next to 4, and so on. A stranger rushing to make a scheduled appointment might think the design calculated to drive him crazy. . . . Any point in the campus seems equally near or far from any other.”

This impression of being lost in space was relieved for some of the 2010 iGEMites by the fact that many of them had been there for previous jamborees and thus they could make sense of the geographical master plan. The tournament started on Friday, November 5, 2010, when 130 iGEM
teams, comprising about 1,300 students, arrived on campus for the three-day event. They came from all reaches of the globe and included thirty-eight teams from Asia, ten from Canada, thirty-eight from Europe, thirty-seven from the United States, four from Latin America, and one from Africa. (No longer was iGEM confined to college and university students: the 2010 competition featured a team from Gaston Day School, a prep school in Gastonia, North Carolina. Its project, “Construction of a Biological Iron Detector in a Secondary School Environment,” was to build an engineered organism that could detect high levels of iron in water sources.)

The teams brought an array of biological engineering schemes, plans, and molecular designs that ranged from the whimsical to the incredible, and from the trivial to serious attempts to address global medical problems by means of artfully rewired microbes. A team from the University of Bristol was pursuing “smarter farming through bacterial soil fertility sensors.” A collaborative effort between Davidson College in North Carolina and Missouri Western State University put microorganisms to work on solving the “knapsack problem.” (Given a set of weighted items and a knapsack of fixed capacity, is there some subset of these items that fills the knapsack?) A group from the Swiss Federal Institute of Technology at Lausanne aimed “to stop malaria propagation by acting on the vector: the mosquito . . . We are engineering
Asaia
, a bacterium that naturally lives in the mosquito's gut, to express an immunotoxin that can prevent the malaria agent,
Plasmodium falciparum
, from infecting the mosquito, thereby eliminating transmission of this parasite to humans.”

The iGEM team from Polytechnic University of Valencia, Spain, had a plan to change the climate of the planet Mars. “We are going to build an engineered yeast resistant to temperature changes and able to produce a dark pigment which will be responsible for a global temperature increase on Mars.” (How's that for redesigning nature?) The team from the University of Washington-Seattle was bent on synthesizing a range of novel antibiotics for the twenty-first century. “Using synthetic biology tools,” they reported, “we designed, built, and tested two new systems to fight infections . . . Our first project targets
Bacillus anthracis
, the Gram-positive pathogen that causes anthrax.”

The competition got under way at 10:00
AM
Saturday, a gray day with a cold wind blowing in from the river. Because the teams were so numerous, and because each team was allotted a full thirty minutes for its presentation, the talks could not be given in a single linear stream, sequentially. Instead, they were split into six divisions that ran concurrently in six different MIT buildings. This meant that six separate groups of judges would gather at the end of the day to compare results and establish rankings.

An iGEM team presentation consisted of a number of essential elements, one of the most important being that the proceeding started and ended exactly on time. The next crucial element was the team uniform, which typically took the form of a brightly colored T-shirt bearing a logo, a bacterial design, and in some cases corporate endorsement patches such as might be worn by an Indianapolis 500 racecar driver. PowerPoint slides, and/or videos, were of course an integral part of things. The final necessary element was frequent use of the word “so” to start a sentence, whether or not the sentence actually followed a previous one or had any kind of logical, organic, or conceptual relation to it. (This is a verbal tic common to geeks of all types, stripes, flavors, and ages.)

A canonical presentation was offered by the Chinese University of Hong Kong, whose team consisted of ten students, each of whom took a turn in giving a segment of the talk, which was held in 26–100 (Building 26, Room 100). The team's goal was to convert
E. coli
bacteria into information storage devices, something on the order of microbial flash drives—or as they called them, bio-hard disks. The group titled its abstract “Bio-cryptography: Information En/Decryption and Storage in
E. cryptor
”
E. cryptor
being the team's name for its designer
E. coli
microbe, which members also referred to as “a living data storage system” They presented a scheme by which all 8,074 characters of the US Declaration of Independence could be encoded, encrypted, and stored in engineered
E. coli
, and then decrypted, decoded, and retrieved back as text.

The first part of their talk was given over to their techniques for translating characters of plain, written text into quaternary (base four) numbers, and then mapping each of the quaternary numbers onto one of the four chemical bases of DNA. For example, the letter H in plain text would
correspond to the number 1020 in the quaternary number system, which in turn would be expressed as TACA in DNA (where 1 is represented by T, 0 by A, and 2 by C). Using such correspondence principles, the plain text word “hello” would become 10201211123012301233 in quaternary encoding and TACATCTTTCGATCGATCGG in DNA encoding. (A program for converting any given text message into quaternary numbers and then into DNA nucleotides can be found at 2010.igem.org/Team:Hong _Kong-CUHK/Model.)

The students described additional techniques for data compression, for deleting repeated sequences, and for ensuring the accurate representation of the message by means of a checksum algorithm. Using these and other means, the team members had calculated that it would take eighteen individual bacterial cells to reliably store the full Declaration of Independence in
E. cryptor
.

Their offering ended with the conjecture that, since essentially any type of information can be digitized, it will one day be possible to reliably store not only text but also pictures, music, and even video—in bacteria. Even among iGEM projects, which are characterized by bold, out-of-the-box thinking, this scheme was notably ambitious.

There were some precedents for writing human language text and images into DNA, however. In 2009 Claes Gustafsson wrote a paper for
Nature
, “For Anyone Who Ever Said There's No Such Thing as a Poetic Gene.” In it, he described how his company, DNA2.0, Inc., during the Christmas season of 2005 gave away free synthetic DNA that encoded the first verse of “Tomten,” a poem by Viktor Rydberg. The verse amounted to fifty words, about eight hundred base pairs long. The protein sequence was back-translated to DNA using the codon bias of reindeer (
Rangifertarandus
; Well, it was Christmas!). Gustafsson's final claim was: “To our knowledge, this is the first example of an organism that ‘recites' poetry.”

An even earlier precedent was set by Joe Davis in 1984–1988 (described in a 1996 article), who cloned a 28-mer length of DNA representing a 5x7 pixel line drawing. W. Wayt Gibbs in his 2001
Scientific American
piece, “Art as a Form of Life,” also described the process and
gave additional insight into Joe's work as well as various earlier Nobellevel molecular engineering pranks.

Going forward, we could amplify libraries of 200 mers by carefully minimizing variation in abundance using flanking universal primers. The design would have extensive adjacent sequence overlaps. This can be made much easier to read than a shotgun human genome, for example, by using (1) precise overlaps instead of ragged, random overlaps and (2) extra base pairs to disambiguate repeats. (3) Compression algorithms (as used for Internet images) can also be used to reduce the number of repeats. (4) Check-bits and other tricks mitigate synthesis and PCR errors. The primers at the ends are designed to enable immediate plug-and-play compatibility with standard next-generation sequencing. We will skip two of the hard steps—assembly of oligos at the beginning and the fragmentation and library-making at the end. High synthetic redundancy and similar levels of analytic (sequencing) redundancy help ensure low error rates.